Блог

Кефир для микрофлоры кишечника


чистка, как влияет, как пить

Считается, что кисломолочный напиток более полезен, чем свежее молоко. Наиболее популярный — кефир. Его употребление приведет в порядок микрофлору желудка и кишечника. Кефир полезен и легок для усвоения, его можно пить хоть каждый день. Этот кисломолочный продукт рекомендован как обязательный ингредиент для диет. Он чистит организм, положительно воздействует на сосуды, восстанавливает пищеварение, помогает при расстройстве. В конце концов, кефир — это просто вкусно.

Кефир – диетический и целебный продукт, прекрасно восстанавливающий микрофлору  кишечника.

Как влияет и чем полезен кефир?

Кефир положительно влияет на систему пищеварения, восстанавливает ее. Продукты в сочетании с ним усваиваются легче. Молочная кислота и бактерии играют роль своеобразного антисептика, поэтому напиток рекомендуется при расстройстве желудка для возобновления его функций, при слабом пищеварении, когда присутствуют процессы брожения. Кефиром проводится очистка организма от токсинов, которые накапливаются во время диет. Он влияет на перистальтику кишечника, усиливая ее. Это превосходное средство при дисбактериозе, при использовании восстановление микрофлоры происходит быстрее. Тогда напиток лучше выпивать утром, перед завтраком. Для больных диабетом этот продукт незаменим, он помогает легче отказаться от сладкого. Напиток содержит массу необходимых организму веществ: белков, витаминов, микроэлементов и молочнокислых бактерий. Благодаря ему улучшается общее самочувствие.

Вернуться к оглавлению

Как пить правильно?

Оптимальная доза напитка на день — это 1−2 стакана. Не стоит им злоупотреблять. Если напиток используется как лекарство, помните, эффект приносит определенное количество живых микроорганизмов, а не количество выпитого продукта. Здоровая микрофлора от того, что вы будете пить его литрами, не появится за день. Если хотите попробовать кефирную диету, то его за сутки разрешается употреблять не больше полутора литров.

Вернуться к оглавлению

Как выбрать?

Выбирайте натуральные кефиры предпочитаемой жирности, а не кисломолочные продукты. Максимальный срок годности натурального продукта — 5 дней. Свежий напиток жидковат, за несколько дней до конца срока годности он густеет. Помните об этом свойстве и выбирайте такую консистенцию и жирность, которая подходит для вас.

Вернуться к оглавлению

Чистка кишечника кефиром

Чистит кишечник напиток любой жирности. Для этой цели выбирать нужно только свежий продукт. Очистка проводится раз в месяц, в этот день можно пить исключительно кефир. Рекомендованный объем — 2 литра. Вместе с кефиром разрешается только вода. Такое очищение подходит для восстановления желудка после обильной трапезы или при расстройстве. Другая очистка растянута на 2 недели: каждый день нужно выпивать стакан кисломолочного напитка и соблюдать при этом вегетарианскую диету. Необходимо много жидкости, предпочтительнее зеленый чай, тогда чистка будет более эффективной. Существуют другие рецепты, гарантирующие очищение и восстановление микрофлоры кишечника.

Вернуться к оглавлению

Кефир с гречкой

Кефир с гречкой — самый известный способ. Гречка не менее целительна, чем кисломолочный напиток, ею тоже можно проводить очищение. Гречка убирает ненужные кислоты, обогащает организм калием, фосфором и кальцием. Она имеет много клетчатки, которая хорошо действует на кишечник, «выметая» все ненужное. Итак, гречка заливается кефиром и оставляется на ночь в холодильнике. Соль и сахар не добавляются. Утром съесть получившуюся кашу (на порцию достаточно 3 ст. ложки крупы). Через пару часов после кефира с гречкой можно позавтракать тушеными овощами, салатом или другим вегетарианским блюдом. Очищение с гречкой должно продолжаться 10 дней, потом сделайте перерыв, продолжая соблюдать диету. Повторите еще раз. Очистка с гречкой подходит почти всем. Эта процедура восстанавливает микрофлору желудка и кишечника, насыщает организм необходимыми микроэлементами, не лишняя при частом расстройстве.

Вернуться к оглавлению

Со льняной мукой

Такое очищение — процедура длительная, требует последовательности и терпения. Лен полезен для кишечника, выводит токсины, но никак не повлияет на микрофлору. Муку лучше сделать самому, так как больше 3-х дней ее хранить нежелательно. В первую неделю процедуры десертная ложка льняной муки смешивается со стаканом кефира. Средство выпивается за раз до завтрака. На 2-ю неделю берите 2 десертные ложки муки на 1 прием. Объем напитка тот же. На 3-ю неделю 3 десертных ложки льняной муки заливаются 1,5 стаканами кефира. В продолжение этих 3-х недель ешьте растительную пищу и употребляйте много жидкости.

Вернуться к оглавлению

Со свеклой

Это очищение подходит людям с лишним весом. Результативность определяется полным отказом от еды на тот день, в который проводится очистка. В этот день разрешается съесть килограмм отварной свеклы, выпить кефир и минеральную воду (по полтора литра). Указанные продукты лучше не смешивать, а употребить раздельно. Свеклу можно натереть на крупной терке, полив оливковым маслом.

Вернуться к оглавлению

С отрубями

Отруби — это самая нужная для кишечника часть зерновых культур, что содержит в себе грубую клетчатку. Их не стоит использовать при расстройстве. Чистка отрубями, кроме самого эффекта, насытит организм нужными веществами, урегулирует количество холестерина. Очищение проводят следующим образом: размешивают столовую ложку отрубей в стакане кефира и сразу все выпивают. Чтобы чистка принесла положительный результат, некоторое время придерживайтесь щадящего питания. Ешьте блюда отварные и запеченные, нежирные, с минимальным количество специй. Такая диета и параллельная чистка принесут ощутимый эффект — восстановление пищеварительных функций и, как следствие, улучшение самочувствия.

Молочно-кислая продукция – один из рекомендованных продуктов для рациона будущих мам.Вернуться к оглавлению

Кефир при беременности

Небольшое содержание алкоголя в напитке, что есть результатом брожения, не повредит ни матери, ни ребенку. Более того, он рекомендуется для беременных из-за наличия в нем фолиевой кислоты, которая способствует развитию клеток. Кефир предотвратит запоры, которыми страдают беременные. Стакана в день достаточно, если хочется, можно больше, но знайте меру.

Вернуться к оглавлению

Противопоказания

Лучше воздержаться от употребления людям, у которых повышена кислотность. В этом случае напиток может спровоцировать изжогу. Для детей до года кефир не является необходимым продуктом, так как состав отличается от материнского молока или адаптированных для младенцев смесей. Индивидуальная непереносимость лактозы — повод отказаться от употребления кефира.

ЭТО действительно ВАЖНО! Желудочно-кишечный тракт нельзя запускать - это грозит раком. Копеечный продукт №1 против болей в желудке... УЗНАТЬ >>

ВАЖНО ЗНАТЬ! Даже 'запущенный' желудочно-кишечный тракт можно вылечить дома, без операций и больниц. Просто прочитайте что говорит Галина Савина читать рекомендацию...

Судя по тому, что вы сейчас читаете эти строки - победа в борьбе с заболеваниями желудочно-кишечного тракта пока не на вашей стороне...

И вы уже думали о хирургическом вмешательстве? Оно и понятно, ведь все органы ЖКТ - жизненно важные, а их правильное функционирование - залог здоровья и хорошего самочувствия. Частые боли в животе, изжога, вздутие, отрыжка, тошнота, нарушение стула... Все эти симптомы знакомы вам не понаслышке.

Но возможно правильнее лечить не следствие, а причину? Рекомендуем прочитать историю Галины Савиной, как она вылечила проблембы ЖКТ... Читать статью >>

Влияние Lactobacillus kefiri, полученного на основе кефира, на иммунный ответ слизистых оболочек и кишечную микробиоту

Оценка воздействия пробиотиков на здоровье хозяина может помочь понять, как их можно использовать для профилактики заболеваний. На основании наших предыдущих исследований и анализов in vitro на PBMC и репортерной системе Caco-2 ccl20: luc, представленных в этой работе, был отобран штамм Lactobacillus kefiri CIDCA 8348, который вводили здоровым швейцарским мышам ежедневно в течение 21 дня.Лечение пробиотиками увеличивало уровень IgA в кале и снижало экспрессию провоспалительных медиаторов в пейеровских бляшках и мезентериальных лимфатических узлах, где также повышалось содержание IL-10. В подвздошной кишке были активированы гены IL-10, CXCL-1 и муцина 6; тем временем в толстой кишке индуцировался муцин 4, тогда как гены IFN- γ , GM-CSF и IL-1 β подавляли. Более того, эксплантаты подвздошной и толстой кишки показали противовоспалительный эффект L. kefiri , поскольку индуцированное LPS увеличение уровней IL-6 и GM-CSF у контрольных мышей было значительно ослаблено у L.kefiri мышей. Что касается фекальной микробиоты, профили DGGE позволили разделить экспериментальные группы на два отдельных кластера. Количественный ПЦР-анализ различных групп бактерий выявил только значительные изменения в популяции Lactobacillus . В заключение, L. kefiri является хорошим кандидатом для использования при воспалительных заболеваниях кишечника.

1. Введение

Взаимодействия между комменсальными бактериями, кишечным эпителием и иммунными клетками играют решающую роль в поддержании гомеостаза кишечника [1, 2].Распознавание микробов через рецепторы распознавания образов индуцирует экспрессию и высвобождение многих различных иммунных медиаторов, таких как хемокины и про- или противовоспалительные цитокины, которые вносят вклад в организацию как врожденного, так и адаптивного иммунного ответа [3, 4]. Использование пробиотиков для модуляции иммунных ответов на слизистых и на системном уровне представляет собой очень интересную альтернативу в отношении профилактики и лечения инфекционных заболеваний [5, 6] и различных иммунопатологий, таких как воспалительные заболевания кишечника и аллергии [7–9] или нарушения обмена веществ [ 10, 11].

Зерна кефира состоят из сложной симбиотической микробиоты, и из них получают кисломолочное молоко под названием «кефир» [12]. Некоторые полезные свойства, такие как иммунологические, противомикробные, противоопухолевые и гипохолестеринемические свойства, были связаны с потреблением кефира [13-17], и изучение полезных свойств, приписываемых изолированным кефиром микроорганизмам, представляет собой область большого интереса для разработки функционального питания.

Сообщалось о иммуномодулирующих свойствах различных дрожжей и бактерий, выделенных из кефирных зерен.Среди кефирных дрожжей Kluyveromyces marxianus CIDCA 8154 и Saccharomyces cerevisiae CIDCA 8112 подавляют врожденный ответ кишечного эпителия посредством механизма, зависящего от модуляции NF-kB [18]. В случае молочнокислых бактерий, полученных из кефира, было доказано, что L. kefiranofaciens уменьшает колит на мышиной модели, вызванной DSS [19], и оказывает противоастматический эффект у мышей с аллергической астмой на овальбумин [20]. С другой стороны, Кэри и Костшинска [21] показали, что L.kefiri ослабляет провоспалительный ответ в эпителиальных клетках кишечника, вызванный Salmonella Typhimurium и Hong et al. [22] показали его влияние на продукцию Th2 и провоспалительных цитокинов на макрофагах.

Одной из самых важных лактобацилл, получаемых из кефира, является Lactobacillus kefiri [23–26]. В предыдущих исследованиях наша рабочая группа продемонстрировала, что продукты секреции и поверхностные белки из L. kefiri оказывают защитное действие против инвазии Salmonella enterica serovar Enteritidis в клетки Caco-2 [27], а также против цитотоксических эффектов клостридиальных клеток. токсины на клетках Vero [28].Более того, было доказано, что штаммов L. kefiri безопасны [29] и прилипают к желудочно-кишечной слизи [30]. С другой стороны, штаммов L. kefiri сохраняют высокий процент жизнеспособности как после сушки распылением [31, 32], так и сублимационной сушки [33]. Все указанные свойства показывают потенциальные возможности L. kefiri как пробиотического микроорганизма.

Изучение механизмов, лежащих в основе действия пробиотиков на хозяина при непатологических состояниях, может быть полезным для оценки безопасности и дальнейшего применения полезных микроорганизмов для профилактики и лечения различных заболеваний.Принимая во внимание потенциальную возможность L. kefiri как нового пробиотика, мы предлагаем оценить иммуномодулирующие свойства выделенных кефиром штаммов L. kefiri с помощью тестов in vitro и in vivo , наряду с изменениями в кишечнике. состав микробиоты, индуцированный введением L. kefiri .

2. Материалы и методы
2.1. Бактериальные штаммы и условия роста

Lactobacillus kefiri CIDCA 83111, 83113, 83115, 8321, 8325, 8345 и 8348 были выделены из зерен кефира [12]. L. kefiri JCM 5818 был получен из Японской коллекции микроорганизмов (Рейкен, Япония). Ранее L. kefiri CIDCA 83115, 8321, 8345 и 8348 были охарактеризованы как агрегирующие штаммы; Между тем L. kefiri CIDCA 83111, 83113 и JCM 5818 были описаны как неагрегативные штаммы [34]. Лактобациллы культивировали в MRS-бульоне (DIFCO, Детройт, США) при 37 ° C в течение 48 ч в аэробных условиях. Замороженные исходные культуры хранили при -80 ° C в обезжиренном молоке до использования.

2.2. Анализ стимуляции с помощью Caco-2 ccl20: luc Reporter System

Эксперименты проводили, как описано ранее [35]. Вкратце, клетки Caco-2, стабильно трансфицированные конструкцией люциферазного репортера под контролем промотора CCL20 (Caco-2 ccl20: luc) [36], сокультивировали в течение 2 часов с суспензией штаммов L. kefiri (10 7 КОЕ на лунку) для тестирования (кратность инкубации = 100). Затем клетки стимулировали флагеллином из Salmonella enterica ser.Typhimurium (FliC) (1 μ г · мл -1 ) в течение 6 часов. Люциферазную активность измеряли на люминометре Labsystems Luminoskan TL Plus (Thermo Scientific, США) с использованием системы анализа люциферазы (Promega, Madison, WI, США). Люминесценцию нормализовали и выражали как процент от среднего значения стимулированного контроля (NAL).

2.3. Эксперименты по стимулированию PBMC

Образцы периферической крови, предварительно протестированные на отсутствие ВИЧ или вирусных инфекций гепатита, были получены от здоровых добровольцев (EFS Aquitaine, Bordeaux Blood Bank).Человеческие PBMC выделяли центрифугированием в градиентах Ficoll-Hypaque. После промывания 2 × 10 6 клеток / лунку культивировали в 12-луночных планшетах в среде RPMI-1640 с добавлением 2 г л -1 NaHCO 3 , 300 мг л -1 L-глутамина, 100 мкг г / мл -1 стрептомицина, 100 МЕ / мл -1 пенициллина (Sigma Chemical Co., Сент-Луис, Миссури, США) и 10% FBS.

Эксперименты по стимуляции L. kefiri на PBMC были выполнены при совместном культивировании 2 × 10 7 бактерий на лунку () в течение 24 часов при 37 ° C в атмосфере 95% воздуха и 5% CO 2 .Супернатанты культур собирали и хранили при -80 ° C до анализа цитокинов. Опыты реализованы в трех экземплярах. Жизнеспособность клеток не изменилась после 24 часов совпадения с бактериями (данные не показаны).

2.4. Количественная оценка уровней цитокинов в супернатантах культур

Профили цитокинов анализировали после стимуляции PBMC штаммом L. kefiri с использованием набора Human Th2 / Th3 11plex FlowCytomix (eBioscience). Он был разработан для измерения человеческого IFN-, γ , IL-1 β , IL-2, IL-4, IL-5, IL-6, IL-8, IL-10, IL-12, p70, TNF- α и TNF- β .Анализ выполняли на проточном цитометре BD Accuri C6 (BD Biosciences). TGF- β измеряли с использованием прибора eBioscience TGF beta 1 человека / мыши Ready-SET-Go! Набор для ELISA (минимальная определяемая концентрация 8,0 пг / мл).

2,5. Мыши

Самцов мышей-альбиносов Swiss, 4-недельного возраста (Janvier, Le Genest St Isle, Франция) помещали на карантин через 2 недели после прибытия и содержали в стандартных лабораторных условиях со свободным доступом к пище и воде. Температуру поддерживали на уровне 22 ° C и выдерживали 12-часовой режим свет / темнота.Все процедуры выполнялись в соответствии с руководящими принципами местного комитета по этике и в строгом соответствии с директивами Европейского экономического сообщества «86/609». Мышей случайным образом делили на две группы (/ группу) и вводили через желудочный зонд 10 8 КОЕ L. kefiri CIDCA 8348 (группа Lk) или PBS (контрольная группа) ежедневно в течение 7 дней и 21 дня; в каждый момент времени забивали по 6 мышей из каждой группы.

2.6. Отбор образцов тканей и стула

Стул собирали на 7, 14 и 21 дни и хранили при -80 ° C до анализа.В конце экспериментального протокола на 7 или 21 день собирали образцы подвздошной и толстой кишки и хранили при -20 ° C в RNAlater (QIAGEN, Hilden, Германия) до экстракции РНК. На 21 день также были удалены пейеровские бляшки (PP) и мезентериальные лимфатические узлы (mLN) и сохранены при -20 ° C в RNAlater для анализа экспрессии, а эксплантаты подвздошной кишки и толстой кишки были собраны в среде RPMI и немедленно обработаны для анализа цитокинов. секреция.

2.7. Количественная оценка экспрессии генов в образцах тканей с помощью qRT-PCR
2.7.1. Экстракция РНК

Общую РНК выделяли с использованием набора RNeasy Mini Kit (QIAGEN, Hilden, Германия) с дополнительной обработкой ДНКазой (Turbo DNA-free, Ambion, Inc.) в соответствии с инструкциями производителя.

2.7.2. Синтез кДНК

Один мкл г тотальной РНК подвергали обратной транскрипции с использованием обратной транскриптазы Maxima (Fermentas, Франция) с праймером заякоренного олиго (dT) 18 в соответствии с инструкциями производителей.

2.7.3. Количественная ПЦР

Количественные анализы ПЦР в реальном времени проводили с использованием системы CHROMO 4 (Bio-Rad).Реакционная смесь содержала Maxima SYBR Green / ROX qPCR Master Mix (Fermentas, Франция), 0,5 мкл моль каждого праймера и соответствующую стандартизованную кДНК в качестве матрицы. Число копий гена-мишени было нормализовано относительно генов "домашнего хозяйства" гипоксантинфосфорибозилтрансферазы (HPRT) и микроглобулина β 2 (B2m). Оценивались гены цитокинов и хемокинов: il1b, il6, il10, il12p70, il17a, il23, ifng, tnfa, tgfb, cxcl1, baff, april, gmcsf ; исследованными факторами транскрипции были foxp3 и rorgt; эпителиального барьера и генов, связанных с IgA, были zo-1, окклюдин, и pIgR ; гены муцина были muc1, muc2, muc3, muc4, muc6, и muc13 .Последовательности праймеров и условия ПЦР доступны по запросу (электронная почта: [email protected]). Для каждой комбинации праймеров была включена реакция отрицательного контроля без матрицы.

2,8. Оценка секреции цитокинов эксплантатами подвздошной и толстой кишки

Эксплантаты подвздошной и толстой кишки культивировали в среде RPMI с добавлением 10% фетальной бычьей сыворотки (Gibco-Invitrogen, Карлсбад, Калифорния, США), 100 мкг мкл -1 стрептомицина и 100 МЕ мл -1 пенициллина G, 100 мкг мкг / мл -1 гентамицина или полная среда RPMI с добавлением 10 мкг мкг / мл -1 LPS из E.coli в качестве стимула (все от Sigma Chemical Co., Сент-Луис, Миссури, США) в течение 24 часов при 37 ° C в атмосфере, состоящей из 95% воздуха и 5% CO. 2 [37]. Супернатанты собирали, центрифугировали и замораживали для последующих измерений цитокинов (IL-6, IL-4, IL-10, IL-17A, IFN-, γ и GM-CSF) (набор Ready-SET-Go! ELISA, eBioscience, Франция). Все анализы были выполнены в соответствии с инструкциями производителя. Минимальные определяемые концентрации составляли 4,0 мкг / мл -1 (IL-6, IL-4 и GM-CFS), 15 мкг / мл -1 (IFN- γ ) и 30 мкг / мл.0 пг / мл (IL-10 и IL-17A).

2.9. Определение общего IgA в стуле

Через 7, 14 и 21 день после обработки L. kefiri уровень общего IgA в стуле измеряли с помощью ELISA согласно методике, описанной BD Pharmigen. Вкратце, планшеты Maxisorp Nunc покрывали в течение ночи очищенным крысиным антимышиным IgA (BD 556969). Планшеты промывали PBS, содержащим 0,05% об. / Об. Tween 20 (PBS-T), и блокировали 10% об. / Об. FBS в PBS. Планшеты инкубировали в течение 2 ч при комнатной температуре с очищенным мышиным IgA каппа (BD 553476) или образцами фекалий.Планшеты выявляли с использованием биотина крысы против IgA мыши (BD 556978), стрептавидин пероксидазы хрена (BD 554066) и триметилбензидина (набор реагентов субстрата TMB BD OptEIA 555214). С помощью микропланшетного ридера Mutliscan FC (Thermo Scientific) оптическую плотность измеряли при 450 нм. Все определения были выполнены в трех экземплярах.

2.10. Анализ популяции микробиоты в кале с помощью q-PCR

Анализ популяции микробиоты в кале проводили на 21 день опыта. Экстракцию ДНК проводили с использованием набора для выделения геномной ДНК NucleoSpin Soil (Macherey-Nagel) в соответствии с инструкциями производителя, за исключением стадии солюбилизации фекалий.Количественную оценку бактериальных популяций проводили с использованием праймеров, синтезированных компанией Biomers (Франция). Реакции ПЦР проводили на системе CHROMO 4 (Bio-Rad) с использованием смеси Maxima SYBR Green / ROX qPCR Master Mix (Fermentas, Франция). В смеси для ПЦР использовали 20 нг ДНК и 0,2 мкл моль л -1 каждого праймера. Для каждой комбинации праймеров была включена реакция отрицательного контроля без матрицы. Кривую плавления снимали от 70 ° C до 90 ° C, считывая каждые 0,5 ° C в течение 2 с. Полученные данные были собраны и проанализированы с помощью Opticon Monitor.Стандартные кривые были построены для чистых культур соответствующих штаммов, экстрагированных по тому же протоколу, что и фекалии. Последовательности праймеров представлены в таблице 1.

)

Популяция Прямой и обратный праймеры (5'-3 ') Ссылка

ACTCCTACGGGAGGCAGCAG
GTATTACCGCGGCTGCTGGCAC
[39]
Lactobacillus группа AGCAGTAGGGAATCTTCCA
ATTYCACCGCTACACATG

GAGCACC 9023ATGACTGACC2 [66]
Bacteroidetes GGARCATGTGGTTTAATTCGATGAT
AGCTGACGACAACCATGCAG

Faecalibacterium prausnitzii AGATGGCCTCGCGTCCGA
CCGAAGACCTTCTTCCTCC
[67]

кишечной палочки CATGCCGCGTGTATGAAGAA
CGGGTAACGTCAATGAGCAAA
[68]

Prevotella группа CACCAAGGCGACGATCA
GGATAACGCCYGGACCT
[69]

клостридий leptum группа GCACAAGCAGTGGAGT
CTTCCTCCGTTTTGTCAA
[70]

Enterococcus spp. CCCTTATTGTTAGTTGCCATCATT
ACTCGTTGTACTTCCCATTGT
Clostridium coccoides group CGGTACCTGACTAAGAAGC CGGTACCTGACTAAGAAGC CGGTACCTGACTAAGAAGC

TCGCGTCYGGTGTGAAAG
CCACATCCAGCRTCCAC

Bacteroides ломкая группа CTGAACCAGCCAAGTAGCG
CCGCAAACTTTCACAACTGACTTA
[72]

Сегментные нитчатые бактерии GACGCTGAGGCATGAGAGCAT
GACGGCACGGATTGTTATTCA
[73]

Lactobacillus murinus GTGGCGAACGGGTGAGTAA
GCACCTGTTTCCAAGTGTTATCC
[74]

Akkermansia muciniphila CAGCACGTGAAGGTGGGGAC
CCTTGCGGTTGGCTTCAGAT
[75 ]

2.11. Качественный анализ фекальной микробиоты с помощью ПЦР-DGGE

HDA1 и HDA2-GC (зажим GC, необходимый для анализа DGGE [38], нацеленный на область V2-V3 [39]) были использованы для оценки микробного разнообразия в каждом образце. Продукты ПЦР разделяли в 8% -ных полиакриламидных гелях (37,5: 1 акриламид: бисакриламид) с диапазоном денатурирующего градиента 30–50% (100% денатурирующий агент состоял из 7 М мочевины и 40% деионизированного формамида), отлитых с использованием модели 475 компании Bio-Rad. система доставки градиента (BioRad, Hercules, CA, США).Электрофорез проводили в буфере TAE 0,5X в течение 5 ч при постоянном электрическом токе 125 мА и температуре 60 ° C с помощью системы обнаружения мутаций DCode (Bio-Rad, Hercules, CA, USA). Кластерный анализ был выполнен с использованием UPGMA (метод невзвешенных парных групп с алгоритмом кластеризации среднего арифметического) для расчета дендрограмм.

2.12. Статистический анализ

Статистические сравнения значимых различий были выполнены в соответствии с критерием Стьюдента.Различия с считались значительными.

3. Результаты
3.1. Цитокиновый профиль PBMC, культивированных с штаммами L. kefiri

Предварительный скрининг восьми штаммов L. kefiri был проведен с использованием PMBC. Были выполнены анализы совместного культивирования РВМС и бактерий и проанализированы профили цитокинов, секретируемых во время инкубации со штаммами. Уровни IL-2, IL-4, IL-5, TNF- β y TGF- β 1 находились в нижнем диапазоне надежного обнаружения.Между тем, для всех протестированных микроорганизмов наблюдалось значительное увеличение концентраций IL-1 β , IL-6, IL-10, TNF- α , IL-8 и IL-12 p70 (Таблица 2). В попытке предсказать тип ответа Th, который они могут стимулировать, мы проанализировали соотношения TNF- α / IL-10 и IL-10 / IL-12 (таблица 3).

40231 9023 902 9023 9023 9023 901 5818 9023

L. kefiri IL-1 IL-6 IL-8 IL-10 IFN- 9023-1 IL-10

CIDCA 8321 1294 ± 526 1552 ± 709 5771 ± 1284 205 ± 76 131 ± 22 10432 9023 9025 3 CIDCA 8325 2050 ± 75 2571 ± 94 4824 ± 531 313 ± 11 59 ± 38 16169 ± 45 572 ± 94
CIDCA 8346 2033 ± 15 4399 ± 106 230 ± 3 85 ± 20 15368 ± 1075 449 ± 21
CIDCA 8348 1936 ± 10 2719 ± 13 2719 ± 13 435 ± 90 83 ± 4 13551 ± 198 502 ± 121
CIDCA 83115 1023 ± 60 1778 ± 12 3621 ± 34 192 ± 9 49236 500 738 ± 206
CIDCA 83111 604 ± 83 2401 ± 81 3806 ± 167 253 ± 1 103 ± 23 99023 ± 175 8152
99023 ± 175
CIDCA 83113 1148 ± 26 1722 ± 95 3920 ± 202 201 ± 11 53 ± 22 7514 ± 427 475 ± 59
919 ± 40 4228 ± 12 84 ± 2 62 ± 13 6872 ± 1647 246 ± 94
Нестимулированный PBMC 35 ± 2 71 ± 6 71 ± 6 21 ± 1 15 ± 1 1 175 ± 5 41 ± 13

900,284

L.кефири TNF- / IL-10 IL-10 / IL-12

CIDCA 8321 50,9 ± 11,4 c, d 3 0,6 d6 ± 0,24 f
CIDCA 8325 51,7 ± 0,1 d 0,55 ± 0,06 e
CIDCA 8345 66,8 ± 4,7 e 0,51 ± 0,51 CIDCA 8348 31.2 ± 0,5 b 0,87 ± 0,18 f
CIDCA 83115 44,9 ± 2,6 c 0,26 ± 0,01 b
CIDCA 83116 0,31 ± 0,02 c
CIDCA 83113 37,4 ± 2,1 c 0,42 ± 0,02 d
JCM 5818 81,8 ± 19,6 34 ± 0,03 c
Нестимулированный PBMC 8,3 ± 0,2 a 0,005 ± 0,002 a

.

Кефир и его преимущества | Чаша добра

О полезных свойствах кефира написано много книг. Этому напитку посвятили свои труды даже серьезные ученые, считая, что регулярное употребление кефира - это секрет долголетия и крепкого здоровья.

Кефир - это культивированный напиток, родом из России. Это ферментированный, богатый ферментами, похожий на йогурт продукт, наполненный дружественными микроорганизмами, белком, микро- и макроэлементами, необходимыми витаминами и минералами - витамином B, витамином K, магнием, фолиевой кислотой, калием, фосфором, и больше.

Люди всегда сравнивают кефир и йогурт и склонны думать, что они похожи. На самом деле они совсем другие. И кефир, и йогурт являются кисломолочными продуктами, но содержат разные штаммы дружественных бактерий. Йогурт содержит только два типа штаммов бактерий с миллиардами полезных микроорганизмов; Кефир, с другой стороны, содержит 10 штаммов с триллионами полезных бактерий, что делает его в 10 раз более полезным, чем молоко или йогурт. И полезные бактерии, содержащиеся в кефире, могут фактически колонизировать кишечник, буквально захватывая его и борясь с вредными бактериями, в то время как те, которые содержатся в йогурте, обеспечивают пищу только здоровым бактериям в кишечнике.

Чем хорош кефир?

Польза от употребления кефира безгранична. Посмотрим, что кефир делает с нашим телом? Прежде всего, полезные свойства кефира обусловлены его содержанием - лакто-культурами - дружественными бактериями, известными как пребиотики и пробиотики. Когда пробиотики и пребиотики сочетаются, они образуют симбиотик. Ферментированные молочные продукты, такие как кефир, считаются идеальным симбиотиком, потому что они содержат живые бактерии и топливо, необходимое им для развития.

Пробиотики - это живые микроорганизмы, которые полезны для здоровья при употреблении в пищу. Ученые, изучавшие кефирные зерна, с удивлением обнаружили, что в кефирных зернах нет ни одной вредной бактерии. Они экспериментировали, добавляя бактерии Escherichia coli к кефиру, и обнаружили, что они были убиты пробиотиками в кефире. Кажется, в кефире не могут существовать болезнетворные организмы.

Полезные бактерии живут в нашем кишечнике и помогают нам переваривать богатую клетчаткой пищу.Состояние кишечной флоры отвечает за качество нашего пищеварения. Чем сильнее ваша кишечная флора, тем лучше будет ваш иммунитет, который, безусловно, можно улучшить, выпив стакан кефира в день.

Кефир обладает как антибактериальными, так и противогрибковыми свойствами. Он содержит кальций, который важен для поддержания здоровья костей и зубов. Врачи рекомендуют кефир при заболеваниях печени, поджелудочной железы, желудочно-кишечных заболеваниях, ожирении.
Кефир - универсальный продукт, контролирующий скорость вашего пищеварения.«Свежий» 1-2-дневный кефир разжижает стул, а 3-х дневный плюс «старый кефир» - наоборот, делает его более твердым.
Кефир также обладает мягкими мочегонными свойствами, поэтому рекомендуется всем, у кого есть проблемы с отеками и даже повышенным давлением.
И он содержит полноценный белок. Если вы хотите получить больше белка, идеально подойдет кефир! Одна порция простого обезжиренного кефира содержит менее 100 калорий, но содержит 10,5 граммов белка, благодаря чему вы чувствуете себя сытым без лишнего жира, что делает его идеальным выбором для тех, кто хочет похудеть.

Известно, что кефир регулирует иммунную систему, способствует выработке желчи, обеспечивает естественную защиту от болезней, улучшает кровообращение, регулирует уровень холестерина и сахара, регулирует кровяное давление, укрепляет почки, замедляет старение и многое другое. Это отличное питание для пожилых людей, беременных и кормящих женщин, детей и людей с ослабленным иммунитетом. Он нацелен почти на всю нашу систему организма и, как известно, лечит множество заболеваний.

Когда лучше всего пить кефир?

Если вы ставите перед собой цель улучшить кишечную флору, ответ на вопрос - пейте кефир, когда желудок максимально пустой.

Если вы просто пьете кефир каждый день, то действительно можете пить его в любое время - утром, днем ​​и даже в вечернем меню. Лучше всего выпить стакан за 1-2 часа до сна.

Кефир, принятый перед сном, улучшает микрофлору кишечника и улучшает сон. Молочные белки в кефире богаты аминокислотой , триптофаном - ключевым продуктом для качественного и спокойного сна, он оказывает успокаивающее и расслабляющее действие.

Если вы пытаетесь похудеть или просто поддерживать свой вес, стакан кефира вечером снизит аппетит.Водный кефир также имеет низкий гликемический индекс (ГИ). Это означает, что он высвобождает глюкозу в ваш кровоток относительно медленнее, заставляя вас чувствовать себя сытым в течение более длительного времени и, следовательно, не испытывать тяги к еде

Противопоказания:

  • Кефир противопоказан детям до года, потому что микрофлора кишечника еще не готова к его перевариванию.
  • Люди со сверхчувствительным кишечником - им может быть не по силам.
  • Людям с непереносимостью лактозы лучше употреблять водный кефир (о нем мы поговорим позже), чем молочный кефир.
    Однако сегодня вы можете найти безлактозное молоко и ферментированный кефир у себя дома, чтобы получить аналогичный напиток.
  • «Старый» кефир противопоказан людям с повышенной кислотностью желудка и изжогой.

Кефирные крупы бывают двух сортов: водный кефир и молочный кефир.

Оба вкусные и полезные для здоровья. Поскольку зерна молочного кефира питаются лактозой, водный кефир идеально подходит для людей с непереносимостью лактозы, поскольку он не содержит молочных продуктов.

Различия между водным и молочным кефиром:

  • Водный кефир: Водный кефир не является молочным и готовится из фруктовых соков, кокосовой воды или такой простой, как фильтрованная вода. Никогда не используйте водопроводную воду, поскольку содержащиеся в ней химические вещества разрушают кефир.
  • Молочный кефир: Молочный кефир также можно приготовить из коровьего, козьего, буйволиного и овечьего молока. Независимо от того, какой тип молока вы используете, зерна кефира способны скармливать и сквашивать любое из них.

Использование

  • Водный кефир: Водный кефир можно принимать в чистом виде или добавлять в смузи без молока.Он может быть ароматизирован и является хорошей альтернативой лимонаду и сокам.
  • Молочный кефир: Молочный кефир можно употреблять как есть, добавлять в коктейли, а также из него можно делать сыр. Хорошо сочетается с кашами и выпечкой.

Как приготовить молочный кефир

Купите кефирные зерна в Интернете, в магазине товаров для здоровья или попросите друга, у которого он есть, поделиться ими с вами - зерна растут очень быстро, и люди обычно очень рады их отдать.

Поместите зерна кефира в чистый стакан с молоком. Аккуратно перемешайте деревянной или пластиковой ложкой, затем оставьте при комнатной температуре на 24-48 часов, перемешивая один раз в день.
После этого зерна кефира должны загустеть и начать расслаиваться на творог и сыворотку. Вкус и консистенция кефира во многом зависят от продолжительности брожения. Чем дольше вы дадите ему бродить, тем гуще и кислее будет ваш кефир.

Когда ваш кефир достигнет желаемого вкуса и консистенции, перемешайте, а затем вылейте его и выпейте.Оставьте зерна - вы будете использовать зерна для следующей партии и так далее.

Как приготовить водный кефир

Смешайте 1/3 стакана сахара с 3 стаканами теплой воды. В основном делай это сладко. Как угодно сладко. Убедитесь, что сахар полностью растворился. Дайте остыть.
Добавьте кефирные зерна в банку с сахарной водой. Вы можете накрыть банку воздухопроницаемой тканью (лично я не делаю этого) и оставить при комнатной температуре, пока наверху не появятся маленькие пузырьки.В результате получается газированный напиток. Готово к употреблению. Для следующей партии используйте крупы.

Вкус напитка зависит от продолжительности брожения. Зерна съедают сахар, поэтому чем дольше вы даете им бродить, тем менее сладким становится ваш кефирный напиток.

Нельзя делать кефир

Никогда не используйте прямую водопроводную воду для водного кефира. Химические вещества в водопроводной воде портят кефир. Вместо этого используйте фильтрованную воду.
Не использовать металлическую ложку при замешивании кефира.Металлы реагируют с кефиром. Вместо этого используйте стеклянную, деревянную или пластиковую посуду.
Кефир не разогревать. Он убивает полезные бактерии.
Постарайтесь не замораживать. Замораживание останавливает брожение, и некоторые зерна трудно восстановить после помещения в морозильную камеру. Если вам необходимо заморозить их (например, в отпуске), постарайтесь заморозить их не дольше, чем на месяц. Когда вы снова начинаете готовить кефир после замораживания зерен, первая партия обычно не очень вкусная, я выливаю ее и делаю вторую, которая обычно снова вкусная.

Счастливого питья!

.

Могут ли собаки есть кефир? - Преимущества и многое другое!

Развитие ветеринарии позволило нам в настоящее время проверить многочисленные преимущества пробиотиков для наших собак. Хотя есть коммерческие добавки, которые могут предложить такое действие пробиотика , натуральные ингредиенты пробиотика всегда считаются лучшими вариантами для наших животных, например, кефир. Кефир - это натуральный ферментированный напиток, полученный из микрофлоры, состоящей в основном из полезных бактерий.В прошлом этот ферментированный напиток часто использовался для лечения туберкулеза или болезней желудка. В последние десятилетия этот натуральный ферментированный напиток с пробиотиком снова стал популярным в рационе человека и стал настоятельно рекомендован диетологами. Кефир происходит из Кавказских гор в Западной Азии.

Если кефир полезен для людей, то наверняка можно спросить, имеет ли он такие же преимущества для их собак. По этой причине в этой статье AnimalWised мы стремимся рассказать вам, что такое кефир, обсудить его свойства и преимущества и, в конечном итоге, ответить на вопрос, может ли ваша собака есть кефир ?

Почему пробиотики важны для собак?

Так же, как и у нас, у наших собак кишечная флора состоит из набора полезных бактерий, которые необходимы для нормального пищеварения.Однако эта микробиота вмешивается не только в пищеварение, но и в метаболические системы и иммунную систему наших собак. Это связано с тем, что микробиота обеспечивает усвоение основных питательных веществ, витаминов и минералов.

Пробиотики предлагают штамм полезных бактерий для наших собак (таких как лактобациллы), которые естественным образом встречаются во флоре кишечника. Дополняя рацион наших собак этими микроорганизмами, мы можем помочь: укрепить их естественную защиту, предотвратить распространение патогенных бактерий в их пищеварительном тракте, оптимизировать усвоение питательных веществ и предотвратить дискомфорт желудочно-кишечного тракта , например чрезмерное газообразование и диарею.

Как мы уже упоминали, пробиотические добавки можно найти в магазинах натуральных продуктов и даже в некоторых ветеринарных клиниках. Однако мы рекомендуем предлагать собаке натуральные пробиотики. Некоторые натуральные пробиотики включают: кефир, мягкие сыры, пахту и йогурт. Однако невероятно важно проконсультироваться с врачом, прежде чем предлагать собаке новый пробиотик.

Что такое кефир?

Кефир - это натуральный пробиотический корм, получаемый в результате ферментации мелких зерен, содержащих бактериальную микрофлору (бактерии, грибы и полезные дрожжи).Среди полезных бактерий, которые составляют эти так называемые гранулы или кефирных узелков , мы можем найти:

  • Lactobacillus delbrueckii subsp. bulgaricus
  • Lactobacillus helveticus
  • Lactobacillus casei subsp. pseudoplantarum
  • Lactobacillus brevis
  • Lactococcus lactis subsp. lactis
  • Streptococcus thermophilus

Присутствие полезных грибов и дрожжей в гранулах кефира очевидно.К таким грибам относятся: Saccharomyces cerevisiae, Candida inconspicua и Kluyveromyces marxianus [1].

Обычно существует три основных типа кефира: вода, молоко и чайный гриб, также известный как чайный кефир. Но на самом деле чайный гриб требует другой формы ферментации, которая включает другую микрофлору и требует особого процесса. Следовательно, правда в том, что существует всего кефира двух видов : водный кефир и молочный кефир.

Что лучше для собак: водяной или молочный кефир?

Кефир молочный называется по-разному в зависимости от страны, в которой вы находитесь.

Молочный кефир, несомненно, самый популярный и потребляемый кефир во всем мире. Возможно, это связано с его вкусом и текстурой, которые очень похожи на традиционный йогурт. С другой стороны, водный кефир имеет микрофлору, почти идентичную молочному кефиру, и его свойства очень похожи и одинаково полезны.

Принципиальная разница между водным кефиром и молочным кефиром - это питательная среда, в которой развивается микрофлора и осуществляется естественный процесс ферментации.Водный кефир не содержит молочных продуктов и часто готовится из воды, фруктового сока или кокосовой воды. С другой стороны, молочный кефир содержит молочные продукты и не содержит дополнительных ароматизаторов.

Польза кефира для собак

Как натуральный пробиотик , кефир является отличным союзником в гонке за здоровое пищеварение. Этот природный пробиотик способствует кишечному транзиту и предотвращает многочисленные расстройства или проблемы с пищеварением, такие как запор, непереносимость пищи и газы. Его полезный штамм бактерий позволяет кишечной флоре сохранять свою целостность и улучшать процесс пищеварения.Он также оптимизирует усвоение основных питательных веществ, витаминов и минералов. Таким образом, кефир также считается эффективной натуральной добавкой, которая может помочь в укреплении иммунной системы и предотвратить многочисленные заболевания и проблемы со здоровьем [2], такие как:

  • Недоедание и дефицит питательных веществ.
  • Воспалительные и инфекционные процессы.
  • Заболевания желудочно-кишечного тракта, включая гастрит.
  • Аллергия и кожные заболевания.
  • Астма и респираторная аллергия.
  • Артрит.
  • Рак.

Можно ли дать собаке кефир?

Да ! Собаки действительно могут извлечь выгоду из полезных свойств кефира! Однако важно проконсультироваться с ветеринаром, прежде чем вносить какие-либо изменения в диету вашей собаки. Профессионал также может помочь вам, когда дело доходит до введения натуральных пробиотиков для собак . Они могут установить подходящую дозу для вашей собаки в зависимости от ее размера, веса, возраста и состояния здоровья.

Хотя кефирное молоко более популярно, водный кефир предлагает те же преимущества и, по сути, имеет преимущество для собак с непереносимостью или аллергией на лактозу. Поэтому мы рекомендуем предлагать собаке водный кефир, так как молочные продукты являются одними из основных пищевых аллергенов для собак. Мы считаем, что водный кефир - лучший вариант пробиотиков для вашего щенка. Еще одно преимущество гранул водного кефира в том, что они требуют относительно простого ухода, что облегчает их хранение.

Где взять кефирные зерна?

В настоящее время кефирные напитки можно найти в некоторых натуральных магазинах или супермаркетах (в некоторых странах).Вы также можете купить кефирное молоко или воду в Интернете. Другой вариант - присоединиться к сайту для раздачи кефира . Обмен - обычная практика среди производителей кефира, и по этой причине существуют онлайн-сообщества, которые позволяют распространять кефирные зерна и культуры.

Хотя кефир только недавно вернул себе популярность, на самом деле это один из первых молочных продуктов, потребляемых человечеством. Упоминания о кефире можно найти в традиционной мусульманской культуре, где он использовался как священный и лечебный напиток.В то время кефир выращивался только в мусульманском сообществе, и его формула держалась в секрете. Это потому, что считалось, что эту священную пищу нельзя употреблять в пищу представителями других религий.

Считается, что Марко Поло был первым западным человеком, который проявил особый интерес к свойствам кефира, упомянув этот пробиотик в некоторых своих трудах. И, наконец, в девятнадцатом веке кефир был включен в западную медицину. Его использовали как естественное средство для облегчения симптомов туберкулеза, симптомов, от которых в то время не было лекарства [3].

Эту историю кефира необходимо знать, чтобы понять, почему существует популяризация донорства кефира, а не его коммерциализация. Пожертвование этого кисломолочного и кисломолочного молока практикуется для создания круга обучения, гарантирующего выживание этой культурной традиции. По этой причине лучший способ получить клубеньки из воды или молочного кефира - это использовать сеть для пожертвований кефира .

Как сделать водный кефир?

Можно сделать вывод, что собаки могут пить кефир.Кроме того, водный кефир - самый простой и быстрый вариант кефира для наших собак. Процесс приготовления и сбраживания водного кефира довольно прост и не требует больших усилий или ухода. Ниже мы предлагаем вам простое пошаговое руководство о том, как приготовить водный кефир для собак, в том числе о том, какие материалы необходимы для этого процесса.

Ингредиенты и материалы (примерно на 1 л кефирадной воды)

  • 3 столовые ложки водного кефира клубеньков
  • 1 литр чистой воды комнатной температуры (без добавления хлора)
  • 2 столовые ложки чистого меда
  • 1 обезвоженный фрукты (можно использовать инжир, сливы или финики, всегда без косточек и косточек)
  • 1/2 лимонного сока
  • Стеклянная банка с широким горлышком
  • Пластиковое ситечко
  • Деревянная или силиконовая ложка (не металлическая!)
  • Это Важно гарантировать, что контейнеры и материалы, используемые в этом процессе, не содержат металла.Металлические элементы будут вмешиваться в процесс брожения клубеньков водного кефира.

Процесс

  1. Возьмите стеклянный сосуд и добавьте 1 литр нехлорированной воды.
  2. Затем добавьте другие ингредиенты и хорошо перемешайте или встряхните, пока все полностью не растворится в воде.
  3. После завершения этой первой части не закрывайте стеклянную банку, так как в процессе ферментации будет выделяться газ. Чтобы в напитке не попали какие-либо примеси или насекомые, можно использовать кусок мелкой сетки и привязать его к банке с помощью резинки или нитки.
  4. После того, как эти шаги будут завершены, достаточно оставить препарат на два или три дня (до успешного завершения процесса ферментации). Но важно следить за тем, чтобы температура окружающей среды составляла от 15 ° C до 30 ° C, чтобы сохранить жизнь микрофлоры, из которой состоят кефирные узелки.

Перед тем, как давать собаке кефирную воду, не забудьте удалить кефирные узелки изнутри смеси. Вы заметите, что микрофлора будет воспроизводиться и появятся новые узелки.Вы можете использовать некоторые из этих зерен для приготовления большего количества кефира или пожертвовать их сообществу кефира.

Кормить собаку кефиром очень просто. Все, что вам нужно сделать, это налить пробиотическую воду в ее миску, как если бы вы это делали с обычной водой. В целом собаки хорошо переносят кефирную воду.

Доза кефира для собак

Регулярное употребление кефира и натуральных пробиотиков очень полезно для наших питомцев, если они получают правильную дозу. В общем, рекомендуемая доза кефира для собак пропорциональна весу каждого животного.Базовый расчет аналогичен для всех натуральных пробиотиков: 1 столовая ложка на каждые 15 или 20 кг.

Тем не менее, важно проконсультироваться с ветеринаром, прежде чем включать какие-либо добавки в рацион вашей собаки. Профессионал может посоветовать вам сумму, подходящую для вашей собаки. Они также могут порекомендовать лучшую форму приема в зависимости от цели потребления и состояния здоровья вашей собаки.

Другие варианты пробиотиков для собак

Если по какой-либо причине вы не хотите предлагать своей собаке кефир, вот список других рекомендуемых натуральных пробиотиков для вашей собаки:

  • Яблоки
  • Грибы
  • Бананы
  • Микроводоросли, суперпродукт на основе океана
  • ферментированный овощи, такие как Sauerkaut

Все эти варианты нужно давать вашей собаке в умеренных количествах.Поэтому мы настоятельно рекомендуем проконсультироваться с врачом, прежде чем предлагать вашей собаке какой-либо из этих рекомендуемых пробиотических кормов.

Если вы хотите прочитать статьи, похожие на Могут ли собаки есть кефир? , рекомендуем вам посетить категорию Домашние диеты.

Список литературы

  1. Prado, Maria R .; Бландон, Лина Марсела; Vandenberghe, Luciana P. S .; Родригес, Кристина; Кастро, Гильермо Р .; Томаз-Соккол, Ванете; Соккол, Карлос Р. Молочный кефир: состав, микробные культуры, биологическая активность и сопутствующие продукты .Границы микробиологии. 30 октября 2015 г.
  2. Оливейра Лейте А., Мигель М., Пейшото Р.С., Росадо А.С., Сильва Дж. Т., Пашоалин VMI (октябрь 2013 г.). Микробиологические, технологические и лечебные свойства кефира: натурального пробиотического напитка . Braz J Microbiol 44 (2): 341-9
  3. Ing. Агустин Тельо Роблес Тельо. Características Principalales de una leche fermentada . Consultado el 5 de julio de 2012.
.

микрофлоры кишечника животных - Энгормикс


Хорошо развитая микрофлора кишечника имеет решающее значение для здоровья наших животных, особенно если мы ожидаем высокой продуктивности. Здоровая нормальная микрофлора - это первая линия защиты от вторжения патогенов, и поэтому она чрезвычайно важна для способности бороться с инфекциями, вызываемыми кишечными патогенами. Кроме того, это также необходимо для нормального функционирования и эффективного переваривания питательных веществ, что приводит к хорошим параметрам роста.

Помимо всасывания питательных веществ, кишечник играет важную роль как самый большой иммунный орган тела. Следовательно, он является частью защитной системы организма и представляет собой важный барьер против вторжения патогенов. Помимо общих защитных механизмов, иммунная система с ее неспецифическими и специфическими реакциями помогает защищаться от патогенных микроорганизмов. Микрофлора кишечника также подавляет болезнетворные микроорганизмы.


Микрофлора кишечника

Микрофлора кишечника включает в себя все бактерии, простейшие и грибы, присутствующие в желудочно-кишечном тракте, и насчитывает от 400 до 500 различных видов.У животных с однокамерным желудком в кишечнике можно найти около 1014 микробов. Первоначально стерильный пищеварительный тракт заселяется микроорганизмами вскоре после рождения. Разнообразие и общее количество микроорганизмов увеличиваются от тонкой кишки к слепой кишке. Микрофлора подразделяется на основную, вспомогательную и остаточную (Гедек и др., 1993). Основная флора состоит в основном из анаэробных видов (бифидобактерии, лактобациллы, бактероиды и эубактерии), которые продуцируют молочную кислоту и другие короткоцепочечные жирные кислоты.Сателлитная флора составляет примерно 1% и состоит в основном из энтерококков и кишечной палочки. Остаточная флора составляет менее 0,01% и состоит в основном из вредных микроорганизмов.


Эубиоз против дисбактериоза

Состав кишечной микрофлоры представляет собой динамическое равновесие между различными видами и меняется в зависимости от условий в пищеварительном тракте. Когда микрофлора находится в равновесии, доля основной флоры составляет более 90%, вспомогательная флора составляет около 1%, а остаточная флора составляет менее 0.01% (рисунок 1). Это состояние называется «эубиоз». В этой ситуации хозяин и микрофлора живут вместе в симбиозе, что означает взаимную выгоду. Хозяин обеспечивает хорошие условия для жизни. В обмен на это микрофлора кишечника, находясь в состоянии эубиоза, поддерживает хозяин с необходимыми действиями. Если эти отношения серьезно нарушены, состояние называется «Дисбактериоз». Дисбиоз может оказать значительное негативное влияние на животное-хозяина. Рост потенциальных патогенов, которые обычно удерживаются на очень низком уровне, может резко увеличиться.Вырабатываются бактериальные токсины, которые могут нанести вред хозяину (рис. 2).

Возможные причины перехода эубиоза в дисбактериоз

Питание - важнейший фактор, влияющий на состав и метаболическую активность микрофлоры кишечника. Ошибки кормления и существенные изменения рациона, низкокачественные компоненты корма и несоответствующая гигиена корма - все это снижает эубиоз (рис. 3). Например, переход с диеты с низким содержанием белка на диету с высоким содержанием белка способствует росту некоторых бактерий, таких как клостридии, и снижает условия для лактобацилл или бифидобактерий.Кроме того, любой стресс может иметь прямое влияние на микрофлору кишечника, поскольку стресс влияет на выделение пищеварительного секрета, а также на тип и частоту кишечных движений (перистальтику).


Пробиотики

Кормление пробиотиками может быть использовано как средство благоприятного воздействия на микробное сообщество кишечника для достижения или восстановления состояния эубиоза. В целом предполагается, что пробиотики действуют следующим образом:

  • Конкуренция с патогенными бактериями за пространство, места прикрепления кишечника и питательные вещества
  • Изменение условий окружающей среды в кишечнике (снижение pH за счет увеличения производства летучих жирных кислот (ЛЖК) и молочной кислоты)
  • Производство антимикробных веществ (лактоферрин, лизоцим, бактериоцины... «Природные антибиотики»)
  • Модуляция кишечного иммунного ответа

Прием пробиотиков должен привести к созданию условий микроэкологии кишечника, которые подавляют вредные микроорганизмы и способствуют развитию полезных микроорганизмов, и в конечном итоге улучшают здоровье кишечника.

В исследовании, проведенном Департаментом питания животных Афинского сельскохозяйственного университета (Mountzouris et al, 2007), была изучена эффективность Biomin® Poultry5Star в питании бройлеров в сравнении с AGP Avilamycin.Biomin® Poultry5Star - это хорошо продуманный мультиштаммовый синбиотический продукт, который сочетает в себе полезные эффекты пробиотических штаммов из родов Enterococcus, Pediococcus, Bifidobacterium и Lactobacillus с пребиотиками.

Результаты

Определяли влияние обработки на параметры продуктивности бройлеров, состав микрофлоры слепой кишки, концентрацию летучих жирных кислот и активность гликолитических ферментов. Общие показатели роста, выраженные с помощью индекса продуктивности бройлеров, были сопоставимы между группами Biomin® Poultry5Star и группой AGP (Рисунок 4).Введение Biomin® Poultry5Star привело к положительной модуляции микрофлоры слепой кишки (рис. 5). Концентрации бактерий, принадлежащих к Bifidobacterium spp., Lactobacillus spp. И грамположительных кокков, были значительно (P ≤ 0,05) выше в группе Biomin® Poultry5Star по сравнению с контролем и группой AGP. Группа Biomin® Poultry5Star имела значительно более высокую (P ≤ 0,05) удельную активность α-галактозидазы по сравнению с контролем, а группа AGP и активность β-галактозидазы была значительно выше (P ≤ 0.05) по сравнению с группой AGP (Таблица 1). Бактериальные гликолитические ферменты играют важную роль в ферментации непереваренных углеводов.

Заключение

Препарат Биомин® Poultry5Star продемонстрировал стимулирующий рост эффект, сравнимый с лечением авиламицином. Кроме того, введение Biomin® Poultry5Star модулировало состав и, в некоторой степени, активность микрофлоры слепой кишки, что приводило к улучшению эубиоза и улучшению здоровья кишечника.


Об авторе

Имя: Микаэла Монл
Должность: Менеджер по продукту
Образование: BOKU - Университет природных ресурсов и прикладных наук о жизни, Вена, спец. Пищевые продукты и биотехнология
Магистерская диссертация: Разработка среды и оптимизация процесса ферментации детоксифицирующих дрожжей охратоксина А
С 2003 г. Докторская диссертация: Разработка процесса ферментации для производства конкурентоспособного продукта исключения для птицы, отвечающего нормативным требованиям для регистрации в ЕС
С марта 2005 года: Менеджер по продукции, Biomin GmbH, Австрия
Адрес: Biomin GmbH, Industriestrasse 21, 3130 Herzogenburg, Austria

.

Смотрите также

MAXCACHE: 0.84MB/0.00054 sec